[894] Expression of Extracellular Matrix Associated Protein Cyr61 in Prostate Cancer: An Immunohistochemical and Quantitative RT-PCR Analysis

A Toubaji, KB D Antonio, R Albadine, AM Mondul, EA Platz, RH Getzenberg, GJ Netto. Johns Hopkins University School of Medicine, Baltimore, MD; Johns Hopkins Bloomberg School of Public Health

Background: Cysteine-rich angiogenic inducer 61 (Cyr61) is an extracellular matrix protein that plays a regulating role in several cellular pathways including cell adhesion, migration and proliferation. Recently, using gene expression arrays, we demonstrated elevated Cyr61 mRNA expression in a subset of prostate cancer (PrCa) lesions. Our current study evaluated the expression pattern of Cyr61 in PrCa, HG-PIN, paired benign prostatic tissue (BPT) and donor prostatic tissue (CTL).
Design: Frozen tissue was used for mRNA quantitative real time reverse transcriptase PCR (Q RT-PCR) analysis using Cyr61 primers (5'-GCAGCCTGAAAAAGGGCAA -3' and 5'-AACATCCAGCGTAAGTAAACCTGAC -3') and probe (5'- AGCAAGACCAAGAAATCCCCCGAACC -3'). Cyr61 mRNA was normalized against Glucuronidase . Amplification was performed using ABI Prism 7700 (Applied Biosystems, CA). TMA sections were constructed from 200 consecutive radical prostatectomy specimens performed at our hospital (2000-2001). Immunohistochemistry was performed using polyclonal antibody for Cyr61 (H-78; Santa Cruz). Semiquantitative visual intensity score for Cyr61 cytoplasmic expression was assigned on a scale of 1-3 in every TMA core. Visual intensity scores were validated by image analysis using ScanScope XT (Aperio Technologies, CA) and open source software packages (TMAJ and FrIDA, Johns Hopkins), in one of the TMAs.
Results: We found a strong correlation between image analysis and visually obtained Cyr61 intensity scores (pairwise CC:0.71; p0.0001). Using Q RT-PCR, we observed significant elevation in Cyr61 mRNA levels in PrCa in comparison to CTL donor tissues (p<0.05). Significantly higher Cyr61 immunoexpression intensity was present in PrCa compared to BPT (p<0.0001). Cyr61 expression intensity was higher in Gleason score 8 PrCA (p<0.01) compared to those with lower gardes. Cyr61 expression in HG-PIN was moderately up-regulated compared to BPT but less intense than associated PrCa (p<0.0001).
Conclusions: Cyr61 expression in PrCa is increased compared to associated BPT. The higher expression of Cyr61 in higher grade tumors suggests a potential prognostic role. A study correlating Cyr61 with PrCa progression is ongoing. Further studies are needed to elucidate the mechanisms by which Cyr61 may contribute to the development and progression of PrCa.
Category: Genitourinary (including renal tumors)

Wednesday, March 11, 2009 9:30 AM

Poster Session V # 98, Wednesday Morning